Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T30899
Clone ID E30899
Template ID T30899
Template Origin Plasmid
Clone Image 3981950
Validity OK
Gene symbol Cox15
Gene description COX15 homolog, cytochrome c oxidase assembly protein (yeast)
Gene Aliases 2900026G05Rik, MGC18952
MGI ID MGI:1920112
Entrez Gene ID 226139
Ref Seq Accession NM_144874
Chromosome Location 19
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter SP6
Sense Promoter  
Forward Primer 018851_F_IRAV24-27_K20_Cox15
Forward Primer Sequences AAGTGGCTCTGCAATCCG
Reverse Primer 018851_R_SP6_IRAV24-27_K20_Cox15
Reverse Primer Sequences GCGATTTAGGTGACACTATAGTTCGAGGAAGGGGGATTC
Template Plate 509-TEM
Template Well D5
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU B
 Template Sequence
AAGTGGCTCT GCAATCCGGA AAAGGGACAG TGTCCCTTCC TTCGAGGGCA GCCGAGCGGG CGGTGGGCCG ATGGCTTCTG GTGTGCAGTG GGACAGTGGC TGGAGCAGTT ATTCTGGGAG GAGTGACCAG GTTGACAGAG TCTGGCCTCT CAATGGTAGA CTGGCATCTG ATAAAGGAGA TGAAGCCGCC CACAAGCCAG GAAGAGTGGG AAGCAGAGTT CCAAAAGTAC CAGCAATTTC CAGAATTTAA AATCCTGAAC CATGACATGA CGCTGGCGGA ATTCAAGTTT ATCTGGTACA TGGAATACTC ACACCGGATG TGGGGGCGAG CTGTAGGCCT TGCATACATC CTGCCTGCTG CCTACTTTTG GAGAAAGGGT TGGCTCAACC GTGGCATGAA AGGACGTGTT CTCGCCCTCT GTGGCTTAGT CTGTTTCCAG GGTCTGTTGG GTTGGTATAT GGTGAAAAGT GGATTGGAAG AAAAACCAGA GTCCTATGAC ATCCCTCGGG TCAGTCAGTA CCGCCTCGCA GCCCACCTGG GGTCAGCACT GGTTCTCTAC TGTGCCAGTC TGTGGACCTC CCTGTCACTG CTACTGCCTC AGCACAAGTT ACCAGAAACT CGGCAGCTCC TGTGGTTGAG ACGGTTTGCT GGTGGCACAG CAGGCCTGGT GTTCCTCACG GCTCTCTCAG GGGCTTTTGT GGCAGGGCTG GATGCTGGCC TCGTTTACAA CTCCTTCCCC AAAATGGGAG AATCTTGGAT CCCAGAGGAC CTCCTGACCT TCTCCCCTGT CCTGAAGAAT GTTTTTGAGA ATCCTACCAT GGTTCAGTTT GATCACAGGC TTCTGGGAGT CACGTCTGTC ACTGCCATTA CAGTGCTCTA TTTCCTGTCC CGGAGAATCC CCCTTCCTCG A