Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T31630
Clone ID E31630
Template ID T31630
Template Origin Plasmid
Clone Image 2647494
Validity OK
Gene symbol Smarcd2
Gene description SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
Gene Aliases AW322457, Baf60b
MGI ID MGI:1933621
Entrez Gene ID 83796
Ref Seq Accession NM_031878
Chromosome Location 11
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter SP6
Sense Promoter  
Forward Primer 013039_F_IRAV08-11_D05_Smarcd2
Forward Primer Sequences AGCCCCAGGACTTCATCC
Reverse Primer 013039_R_SP6_IRAV08-11_D05_Smarcd2
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGCAGCCGCTTGCATAGAT
Template Plate 516-TEM
Template Well G12
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU B
 Template Sequence
AGCCCCAGGA CTTCATCCAG GAGTGGCTCC GTTCCCAACG CCGAGACCTC AAGATCATCA CAGATGTGAT TGGAAACCCT GAGGAGGAGA GACGAGCTGC TTTCTACCAC CAGCCCTGGG CTCAGGAAGC AGTGGGGAGG CACATCTTTG CCAAGGTGCA GCAGCGAAGG CAGGAACTGG AACAGGTGCT GGGAATTCGC CTGACCTAAC TGCTCAGGGA TTGCCTCCTT CCTTCCTCCC CTGCCCTGGA TGGAACCTGG CAAGAGCCCG TCCTCTGGGT TCTGGCTTGG GCTGCAGACA TGTAGGATGG AGTGAGGTGT GTTTCCTGTC ACCCTCCACT CCCCAGCTTT AGTTTCATAA ATGTAGTTTT AGATCCCTCA CTGCTTGGTT CCCAAAGCCT TATTACTGAC CTTTTAGCGC TGGCTTTAAT TGGGTTTGCA ATGAGCGGCC TCAGCCCCCT GCAGGCAGGC AGGCCTGAGT AGGAGGCTGG AGGCTGTGCT TTAACTTTGT ACCAGACATT TCCAAACCAA AGGCTGCTGG GTTTGCATGT TTACAGGCTC CACCCTAGGG CCAGTGCCAG AGCTGGCTTT GGGGAGCTGG GCAAGGAAGA GAAGGCCCTA GACTCTTCCT GGCCTTTCTA ACCAAAGTTT TTTGCCATTC CTACAAGCCC AGTCTTGCTG CTGGTTTGTC CTTCTTTTTG GGTATTTGCA CTATTTGGGG AGCAGGTTTT TCTATGTGGG AGCCACTTTT TTTGTACAGA GGTAATGGGG TTTTTCAGGG AGCCCACTTG GTGCCTCCTT CTTCCTTTCT TTTCTTAATC TATGCAAGCG GCTG