Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T35471
Clone ID E35471
Template ID T35471
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Irx4
Gene description Iroquois related homeobox 4 (Drosophila)
Gene Aliases  
MGI ID MGI:1355275
Entrez Gene ID 50916
Ref Seq Accession NM_018885
Chromosome Location 13
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 074902_F_cDNA_Irx4
Forward Primer Sequences TGGATAGTGGACCAGAGAGGAT
Reverse Primer 074902_N_SP6_cDNA_Irx4
Reverse Primer Sequences GCGATTTAGGTGACACTATAGTGTGCTCTCCGGTCTTCTCAT
Template Plate 10007_TEM
Template Well 10007_TEM_C03
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence
TGGATAGTGG ACCAGAGAGG ATTCCTGCTT CATCTGATGG TCCCGGCACA GGCAAGGAGG CCTCCACCAC ACTCCGGATG CCCCTGGGCA CCGCTGGTGG AGCTGTTATG GATGGGGATC TGGAGAGGGC AAGGAACTGC CTCCGGAGCA CAGTGGTCGT TCCTGACTCT GGCGCCGAGG GCGGCCCACC TGCTTGCGAA GCCAAACTGA CCTTTGCTCA GGCGGGAGCG CCGCCGAACC TGGAGACCAA GCCCCGCATC TGGTCCTTGG CACACACAGC CACCGCTGCT GCAGCCACAG CTCTGAGCCA GACTGAGTTT CCCTCCTGCA TGCTGAAACG CCAAGGTCCA ACGGGTGTAT CTGCGACGAC GCCAGCGTCC TCACCTGCAG TCACGGCCCC TTCTGGGGCT CTGGATAGGC ACCAGGACTC CCCAGTAACT AGCCTCAGAA ACTGGGTGGA TGGGGTATTT CACGATCCCA TCCTTAGACA CAGCACTTTG AACCAGGCCT GGGCCACCGC TAAGGGCGCA CTTCTGGATC CCGGCCCTCT AGGACGCAAT CTGGGGGCGG GTACTAACGT ACTGACGACG CCCCTTGCTT GCTCCTTCCC GCCCACGGTG CCCCAAGACG TCCCACCTGC AGGGGCCTCC CGGGAGCTGC TGGCTACGCC CAAGGCCGGT GGCAAACCCT TCTGCACTTA ACACCCACCT GCACAGTGGA GAAGGGAACT GGCGCTCAGG CTGCAGGCGC TGACTCTGAA CTGCTTTAAA TGGGTTTCCA AAAGAAGGGG GAATTTCCAA GCCAAGATTG CCAACCCACT TGAGACAGAG GATTTGAACT CAACCTCCAG GGCTATGGAG GAACTCCTCG CGTTCTATCA CCAGGTTTTA CCTGATGTTG CGTCCACCTG AGCCATCCCT TAACTCCAGG AAGATGAGAA GACCGGAGAG CACAGCCGAT GGGAGGCCCC CTGAAGCATA AAGTTTAC