Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T35889
Clone ID E35889
Template ID T35889
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Adamts8
Gene description a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8
Gene Aliases METH-2, METH2
MGI ID MGI:1353468
Entrez Gene ID 30806
Ref Seq Accession NM_013906
Chromosome Location 9
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 099944_F_cDNA_Adamts8
Forward Primer Sequences TGTGTACTCAAGGAGGATGTGG
Reverse Primer 099944_N_SP6_cDNA_Adamts8
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGTTGCTCTTTCCTTGCTATTCTG
Template Plate 10014_TEM
Template Well 10014_TEM_D04
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence
TGTGTACTCA AGGAGGATGT GGAGAATCCC AAGGCTGTGG TAGATGGAGA CTGGGGTCCC TGGAGACCCT GGGGACAATG TTCTCGCACC TGTGGTGGAG GGATACAATT CTCGAACCGT GAATGTGATA ATCCAATGCC TCAGAATGGA GGAAGATTTT GCCTGGGTGA AAGAGTCAAG TACCAATCAT GCAACACAGA GGAATGTCCA CCAAACGGAA AAAGCTTCCG GGAGCAGCAG TGTGAGAAAT ATAATGCCTA CAACCACACT GACCTGGATG GGAATTTCCT GCAGTGGGTC CCCAAGTATT CAGGAGTGTC CCCCCGAGAC CGATGCAAGC TGTTTTGCAG AGCCCGTGGG AGGAGTGAGT TCAAAGTGTT TGAAGCTAAG GTGATCGATG GCACTCTGTG TGGACCGGAT ACTCTGTCCA TCTGCGTCCG GGGGCAATGT GTTAAGGCTG GCTGTGACCA TGTGGTGAAC TCACCTAAGA AGCTGGACAA ATGTGGGGTG TGTGGGGGCA AAGGCACTGC CTGTAGGAAG ATCTCCGGTT CTTTCACCCC CTTCAGTTAT GGCTACAATG ACATTGTCAC CATCCCAGCT GGTGCCACAA ACATTGATGT GAAACAGCGG AGTCACCCAG GGGTCAGGAA CGACGGCAGC TACCTGGCGC TGAAGACAGC CAATGGGCAG TACCTGCTCA ATGGTAACCT GGCCATCTCT GCCATAGAGC AAGACATCTT GGTGAAGGGG ACCATCCTGA AGTACAGTGG CTCCATGGCT ACCCTGGAGC GGCTGCAGAG CTTCCAGGCC CTGCCTGAGC CTCTTACAGT ACAGCTCCTG ACTGTGTCTG GTGAGGTCTT CCCTCCAAAA GTCAGATATA CCTTCTTTGT CCCCAATGAC ATGGACTTCA GCGTGCAGAA TAGCAAGGAA AGAGCAACCA CCAACATCAT TCAGTCACTG