Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T36450
Clone ID E36450
Template ID T36450
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Grid2ip
Gene description glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1
Gene Aliases  
MGI ID MGI:2176213
Entrez Gene ID 170935
Ref Seq Accession NM_133355
Chromosome Location 5
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 092364_F_cDNA_Grid2ip
Forward Primer Sequences AACAGGTGGAGAACTCAGAAGG
Reverse Primer 092364_N_SP6_cDNA_Grid2ip
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGTCTTGTTGGTCTTGGGCTGT
Template Plate 10024_TEM
Template Well 10024_TEM_G06
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU  
 Template Sequence
AACAGGTGGA GAACTCAGAA GGCACCATCT GGGGTCAGCT TGGGGAAGAC TCTGACTATG ACAAGCTGAG TGACATGGTG AAATACCTCG ACCTGGAGCT CCACTTCGGC ACCCAGAAAC CTCCGAAGCC AGTGCCCGGC CCGGAGCCCT TCAGGAAGAA GGAAGTGGTG GAGATCTTGT CCCACAAGAA GGCCTACAAT ACCTCCATTC TCCTAGCGCA CCTGAAGCTG ACCCCTGGCG AGCTGCGGCA AGTGCTCATG AGCATGGAAC CCCGGCGCCT GGAGCCTGCT CATCTGGCGC AGCTGCTGCT CTTCGCTCCT GACGCCGACG AGGAACAGCG ATATCAGGCT TTCCGCGAGG CTCCGGGTCG CCTCAGTGAG CCGGACCAGT TCGTCCTGCA GATGCTGTCG GTTCCCGAAT ACAAGACCCG CCTGCGCAGT CTACACTTCC AGGCTACCTT GCAGGAGAAG ACAGAGGAGA TACGAGGCAG CCTCGAGTGT CTGCGACAGG CATCTCTGGA GCTCAAAAAC AGCCGGAAAC TCGCCAAGAT CCTGGAGTTT GTGTTGGCCA TGGGTAACTA TCTCAACGAT GGACAGCCCA AGACCAACAA GACCACTGGC TTCAAGATCA ACTTCC