Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T37782
Clone ID E37782
Template ID T37782
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Lmod2
Gene description leiomodin 2 (cardiac)
Gene Aliases C-Lmod
MGI ID MGI:2135672
Entrez Gene ID 93677
Ref Seq Accession NM_053098
Chromosome Location 6
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 079268_F_cDNA_Lmod2
Forward Primer Sequences TTTGGCTACAGAAGGGGACTTA
Reverse Primer 079268_N_SP6_cDNA_Lmod2
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGCTGAACGTCTTCACCACTGT
Template Plate 10047_TEM
Template Well 10047_TEM_D09
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence
TTTGGCTACA GAAGGGGACT TAGTAAATAT GAATCCATTG ATGAGGATGA ACTTCTGGCC TCCCTCTCAC CTGAAGAGCT GAAGGAGCTT GAGAGGGAGC TGGAAGACAT TGAACCTGAC CGAAACCTTC CTGTGGGGCT AAGGCAAAAG AGTCTGACAG AGAAAACCCC AACAGGAAAC TTCAGCCGAG AGGCGCTGAT GGCGTATTGG GAAAAGGAGT CCCAAAAACT TTTGGAGAAG GAACGGCTGG GGGAATGTGG AAAGGTTGCA GAAGAAGACA AGGAAGAGAG TGAAGAGGAA CTAATTTTCA CAGAGAGCAA CAGCGAAGTC TCTGAGGAGG TGTGTACAGA AGATGAGGAA GAGTCTCAGG AGGAAGAAGA GGATAGCGAG GAAGAAGAGG ACAGTGAGGA AGAGGAAGAG ACAACAGAAG CCACAAAACA TATTAATGGA ACTGTAAGCT ACAATAGTGT TAATACTGAT AACTCTAAGC CAAAGACATT TAAAAGCCAA ATAGAAAATA TAAATTTAAC CAACGGCAAC AGTGGAAGAA CACAGAGGAA CTCCGAGTCA CCAGCCGCCA TTCACCCTTG TGGAAATCCC ACTGTTATTG AGGATGCTCT GGAAAAGATT AGAAACAATG ACCCTGATAC GACAGAAGTT AATCTGAACA ATATAGAGAA CATCACCACC CAGACCTTAT CCCGATTTGC TGAAGCTCTC AAGGAGAACA CAGTGGTGAA GACGTTCAGC CTGGCCAACA CGCACGCTGA TGACGCCGCG GCGATTGCCA TTGCAGACAT GCTCAAGGTT AACG