Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T38906
Clone ID E38906
Template ID T38906
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Hdac9
Gene description histone deacetylase 9
Gene Aliases AV022454, D030072B18Rik, HD7B, HD9, HDRP, Hdac7b, Mitr, mKIAA0744
MGI ID MGI:1931221
Entrez Gene ID 79221
Ref Seq Accession NM_024124
Chromosome Location 12
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 270552_F_cDNA_Hdac9
Forward Primer Sequences CCTTCACTGGTAAGAAAATGCC
Reverse Primer 270552_N_SP6_cDNA_Hdac9
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGTATTTGCCAGAACGATCTGATG
Template Plate 10087_TEM
Template Well 10087_TEM_C10
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence
CCTTCACTGG TAAGAAAATG CCTGCTACAC TAAAAATATG CTATATACTA TCCAAGTAAT CAATAGGCTC TAAGTCCACC TCAAAGCCTG ATACAACAGT TCCTTCTACG GAAAACGAAC TTACTGCTGT TTGTAGTTTT ATCTGCTGAG GTCTGTGAGT ACAAAATATA GTTTCCCAGC CTGAATAATG AATCATTCAT TCTATTAGAT TTAATGTTTT TTAACATATA GAACTGTTTT CATATGACTG TACATACTGT ATCATACTAC AGTCTGGAAC ACTGTTGAAG GTAGTCTGCC CTGCCCCCCT TTCCTCTCCC TCTCTATCTC TCTCTCTCTC TTTTTAAAAT TTTTTTTTGT TAAGTTGAAA TGTTGTGGTT ATCATGCCAG TAGCTCTAGG TTATTGTGTA GATTACAACT GAAAATCTTA CCAGTTCAGG TGGTTTTAAG TAGAGACTCA AACCGAAGCT CTGTTTTGAA CATGACACTA TGTCTACCAT AGCGCTGCAC AGTTTACATA AACCTTTTGT AATTTGCTGA CATTATATAT GGAAAAAGAT CAAATGAAGC TGACGCAAAT GTTGCTGAGA AGGAATGTAG AGCATGGTGG TCCAATCAGA TGCTGCGATG TATGGCCAGC TGCAGAAAGC ATAGTATGAC TACCACCTGC TATCAAATTA AAACCAGTTT TACAAGAGGA TGACTCACGT TTATACCTGA TATCTTTAGA ATCTCTGGCA TACAGTTCCA TGGCATACAT CAGATCGTTC TGGCAAATAC AAAAATATGA ATGTTGGATT TAACAGAATA ATCTGCTTGT ATATAATGCA CCTCCAGAAG GACTATGTC