Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T3895
Clone ID E3895
Template ID T3895
Template Origin Plasmid
Clone Image 5009577
Validity OK
Gene symbol Inha
Gene description inhibin alpha
Gene Aliases AW555078
MGI ID MGI:96569
Entrez Gene ID 16322
Ref Seq Accession NM_010564
Chromosome Location 1
ENSEMBL Transcript ID  
ENSEMBL Gene ID ENSMUSG00000032968
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate  
Template Well  
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC056627
TGU  
 Template Sequence
GCCATGGGCA GGGGCGACTG GGACTGTGGG GCGTGGGAAG GACTGGGGGA GACTGGGGTG AGAAGGGTAG AAGAAGGCCA GCAGTGGGAT GGGGAGGGGA CAGTGGGGAG GTCCTAGACA GAAAGGGCAC AGGGCAGCGT GTGGGTTCCC TGTCATCAGG GCAAGTGAAC TATGGTGAGC CAGCGGTCTC TGCTGCTCCT TTTGCTGTTG ACCCTACGGG ATGTGGACAG CTGCCAGGGG CCCGAACTTG TCCGGGAGCT CGTCCTGGCC AAGGTGAAGG CTCTATTCCT AGATGCCTTG GGGCCCCCAG CAATGGATGG GGAAGGTGGG GATCCTGGAA TAAGGCGTCT GCCTCGAAGA CATGCCGTTG GGGGTTTCAT GCACAGGACC TCTGAACCAG AGGAGGAAGA TGTCTCCCAG GCTATCCTTT TCCCAGCTAC AGGTGCCACC TGTGAGGACC AGCCAGCTGC CAGAGGGCTT GCCCAGGAGG CTGAGGAAGG CCTCTTCACT TATGTATTCC GGCCATCCCA ACACATACGC AGCCACCAGG TGACTTCAGC CCAGCTGTGG TTCCACACAG GCCTAGGCAG GAAGAGCACA GCAGCCGCCA ATAGCTCTGC GCCCCTGCTA GATCTTCTGG TGCTATCATC TGGGGGGCCC ATGGCTGTGC CTGTGTCCTT GGGACAGGGC CCGCCACGCT GGGCTGTACT GCACCTGGCG GCGTCTGCTT TCCCTCTGCT GACCCACCCC ATCCTGGTGT TGCTGCTGCG ATGCCCACTC TGTTCCTGCT CGGGCCGGCC TGAGACCACT CCTTTCCTGG TAGCCCACAC TAGGGCTCGA GCACCCAGTG CGGGGGAGAG GGCCCGGCGT TCAACTCCCT CCGTGCCTTG GCCTTGGTCT CCTGCGGCTT TGCGCTTGCT GCAGAGGCCT CCCGAGGAAC CCGCTGCGCA TGCCTTCTGC CATCGAGCTG CTCTCAATAT CTCCTTCCAA GAGCTGGGCT GGGACCGCTG GATCGTACAC CCTCCCAGTT TCATCTTCCA CTACTGCCAT GGTAGCTGCG GGATGCCCAC ATCTGACCTG CCCCTGCCAG TCCCTGGGGT GCCCCCTACC CCGGTTCAGC CCCTGTTTTT GGTGCCAGGG GCCAAGCCCT GCTGTGCTGC TCTTCCGGGG AGCATGAGGT CCCTACGCGT CCGAACCACC TCAGATGGAG GTTACTCTTT CAAGTATGAG ATGGTACCCA ACCTTATTAC TCAACACTGT GCTTGTATCT AAAAGCACCT CCGCCTCCTC CTCCCATAGC CGATGGCCAC AGTCAATTCA CCACCCCAGG GTCCTCAGCT AGGAGGAGGA CAGAGTGTGG AAAGTAGACA GTTTCCACTT CCTTTTCCCT ACATCTTTCA GTATGAGGGA TCCATATCCT GCTCCACCCA GGTCCTGTGG ATAACAATAA AAAAGGAAGT GTGAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAA