Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T4796
Clone ID E4796
Template ID T4796
Template Origin Plasmid
Clone Image 5052843
Validity OK
Gene symbol Creb3l2
Gene description cAMP responsive element binding protein 3-like 2 (Creb3l2)
Gene Aliases BBF2H7, C530025K05Rik
MGI ID MGI:2442695
Entrez Gene ID 208647
Ref Seq Accession NM_178661
Chromosome Location 6
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 53
Template Well E11
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC043466
TGU M
 Template Sequence
GGGCTTGTTG CGCGAGGACT TTCTTGGGAT GAGCGCTGCC TTTTTGCCTT CCTTTTGGAT GCACAGCCCG ATTTAACCCC TGCACCTTCC GCCCGATCCC AGCAGGCTTG TCCTCCCCGG GGAGTCACAG ATTTCCGAGG ACAAGGGTCG CGTAGCCTTC GGCAGGGCTC TCCCGAGTTC CTGCTCCAGT GCATAAGTTC CACGCGCGCA CACGCCAAGT ACACGGGGAG AAGCGTCTCA CCGGCCCGCG GCGGCTCTGC GCGGTCCCCT CCTGCCTCAG CATCCTCGGC CCTGCGCGGC GCCCACCGCC ATGGAGGTGC TGGAGAGCGG GGAGCAGAGC GTCCTGCAGT GGGACCGCAA GCTGAGCGAG CTGTCAGAGC CCGGAGAGAC TGAGGCCCTC ATGTACCACA CGCACTTCTC GGAGCTCCTA GACGAGTTTT CCCAGAACGT CCTGGGTCAG CTCCTGAGTG ACCCTTTCCT CTCAGAGAAG AGCGAGTCAA TGGAGGTGGA GCCATCTCCA ACATCACCAG CGCCTCTCAT CCAGGCTGAA CACAGCTACT CTCTGAGCGA GGAGCCCCGG ACTCAGTCAC CATTTACCCA TGCGGCTACC AGCGACAGCT TCAATGACGA GGAGGTGGAG AGTGAAAAAT GGTACCTGTC TACAGAGTTT CCTTCAGCTA CCATCAAGAC AGAGCCAATC ACAGAGGAGC AGCCCCCGGG ACTTGTCCCT TCTGTCACTC TGACCATCAC AGCCATTTCC ACTCCTTTTG AAAAAGAAGA GTCCCCTCTG GATATGAATG CTGGGGGGGA CTCCTCGTGC CAGACGCTTA TTCCTAAGAT TAAGCTGGAG CCGCACGAAG TGGATCAGTT CTTAAACTTC TCCCCGAAAG AAGCCTCCGT GGATCAACTG CACTTACCAC CAACACCACC CAGTAGTCAC AGCAGTGACT CTGAGGGCAG CTTGAGCCCC AACCCACGCC TGCATCCCTT CAGCCTGTCT CAGGCCCACA GCCCTGCCAG AGCCATGCCC CGGGGCCCCT CTGCCTTGTC CACATCTCCT CTCCTCACAG CTCCACATAA GCTGCAGGGA TCGGGCCCCC TGGTCCTGAC AGAAGAGGAG AAGAGGACCC TGGTTGCCGA GGGCTATCCC ATTCCCACCA AGCTGCCTCT GACAAAATCT GAGGAGAAGG CCCTGAAGAA AATCCGGAGA AAGATCAAGA ATAAGATTTC TGCCCAAGAA AGCAGGAGAA AGAAGAAAGA ATACATGGAC AGCCTGGAGA AAAAAGTGGA GTCTTGTTCA ACTGAGAACT TGGAGCTTCG GAAGAAGGTG GAGGTGCTGG AGAACACCAA TAGGACTCTC CTTCAGCAAC TTCAGAAGCT TCAGACTTTG GTGATGGGGA AGGTCTCTCG AACCTGCAAG TTAGCTGGCA CACAGACTGG CACCTGCCTC ATGGTCGTTG TGCTTTGCTT TGCTGTTGCA TTTGGAAGCT TCTTTCAAGG CTATGGGCCT TATCCTTCTG CCACCAAGAT GGCTCTGCCC AGCCAGCATC CTCTGTCAGA GCCATACACA GCCTCCGTGG TGAGATCCAG GAACCTGCTA ATCTATGAGG AACACGCTCC CCTGGAAGAG TCGTCGAGCC CAGCCTCAGC CGGGGAGCTG GGGGGCTGGG ACAGAGGCTC CTCTCTGCTC AGGGCATCGT CGGGGCTTGA GGCCCTGCCA GAGGTGGATC TTCCCCATTT CCTTATCTCC AATGAGACGA GCTTGGAGAA GTCAGTACTG TTGGAGCTTC AGCAGCACCT GGTCAGCAGC AAACTGGAAG GGAACGAAAC ACTCAAGGTT GTAGAGCTGG AGAGGAGAGT GAACGCCACC TTCTGAGGAG AGCTCCACCC GCCTCTTCTC CTAACTCCAT CTGATCGTCC TTTCAGTTTC CCCTTCACCA CTGGATCTCG AGGAGGAGAT GGCCTAGTGT TACGGCTCGA GACAGGAGGC CAGCCCAGGG GGTTCTGCTT GTGTGTCCCC GTGGCTCTCC ACAAAAGGGA GCTAGCACCT CTCCATCCCT TTCTCTTACT GCCATTGGAA ATTATTTTAG GGCTGAGATA GGGGTGGAAC GAGCAGGCTT GTTTCCACCA ATAGTGCCAA GAAGACACTG CCTGATTCTT CCCCGGGAGG AGTGACTCCT CTGAAGACGA CATGACTCAT GTTCAGTTGA GACCCCAGAC TCTAGCCACA CACATGCCAC AGACATGCCA GGGAGTGGCA AAGCACTGAC TCCTGAGCTC CCTTCCTCAC TAGGACTCCA GTGTGACCCT GCACTGAGAG GACCAAAGCG TCATTGCAGT CTTCTCTCCA CCCTGTACCC CGGAGTCCTG ATTGGATGTC TGCAGAGGCA GATGGGGCTC CCACCATATT TTCAGGCCGC AAGTGCAATT CCTGAAGGCA TCAGGCTCTT CTCTCCCAGG CTCTCCTGCC CACTGTGTTG TTTGTAGGAC ACCCCCACAC CCACTCATAC ACAGCCTGCA TCTCCACAGG ACAATAGCTC TGTCTCCCTG GCCTCCCCTC CCCATTTGTA AATAGTATTT ATTAGCTTGC TCAAGCTCCC AGCTGGCCAT AGTGAAAAGA TTTCCCCTTT CAACCAGCAA AGTCTTCTGT TGGCCTTTGG AACAGGAGAG TCCCCGGAAT CTAGGACCCT AGTCTTTGTA CTTGATGCCT TGTTTCCCCC CTTTTCTTCT TTAAAATTGG GGACCTATAA CATCATCGCT GTTGCGGAAT CCACTTAGGC ATGTGTCCCC TGATGGATGA ATACATGGGA ATGGTGGATA CTGTCTTCTG ACTCAGGCTC TAGGCTCCAT GGCTTCCTCT CTCTGGTCCT GCCACACAGA AGGAAAGCCC TGTCCAGGAT AATGAGCGTT GCTGACACCC TTGCTAGCTT GTCCTGCCTA CCTGCTTACC CCACTCCCTC ACCTTCCTCC TTCCCTTCTG CCCTCCATCC ACCTGCCTTA ACTAATTGGG GCTGGAGTTG GTCATTTTTG TACACCCACA GTGGTACCTT TTACAGTCAG GTTTGGATAC TTTGCAGCTC ATCCAAAGAG ACATAACTAA ACCCTAAACT CTTTTTTTGT TGTTGTTGTT GTTGGTTTTT TTTTTTATGA TTAAAAAGTA AAAATTGTAG TTTAAAAAAA AAAAAAAA