Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T7506
Clone ID E7506
Template ID T7506
Template Origin Plasmid
Clone Image 4238842
Validity OK
Gene symbol Hnf4a
Gene description hepatic nuclear factor 4, alpha
Gene Aliases D19Mgi10, HNF-4, Hnf4, MODY1, Nr2a1, Tcf14, Tcf4
MGI ID MGI:109128
Entrez Gene ID 15378
Ref Seq Accession NM_008261
Chromosome Location 2
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 81
Template Well F08
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC039220
TGU M
 Template Sequence
GGGACCTGGG AGGAGGCAGG AGGAGGGCGG GGACGGGGGG GGCTGGGGCT CAGCCCAGGG GCTTGGGTGG CATCCTGGGC CGGGCAGGAC AGGGGGCTAA GGCGTGGGTA GGGGAGAATG CGACTCTCTA AAACCCTTGC CGGCATGGAT ATGGCCGACT ACAGCGCTGC CCTGGACCCA GCCTACACCA CCCTGGAGTT TGAAAATGTG CAGGTGTTGA CCATGGGCAA TGACACGTCC CCATCTGAAG GTGCCAACCT CAATTCATCC AACAGCCTGG GCGTCAGTGC CCTGTGCGCC ATCTGTGGCG ACCGGGCCAC CGGCAAACAC TACGGAGCCT CGAGCTGTGA CGGCTGCAAG GGGTTCTTCA GGAGGAGCGT GAGGAAGAAC CACATGTACT CCTGCAGGTT TAGCCGACAA TGTGTGGTAG ACAAAGATAA GAGGAACCAG TGTCGTTACT GCAGGCTTAA GAAGTGCTTC CGGGCTGGCA TGAAGAAGGA AGCTGTCCAA AATGAGCGGG ACCGGATCAG CACGCGGAGG TCAAGCTACG AGGACAGCAG CCTGCCCTCC ATCAACGCGC TCCTGCAGGC AGAGGTTCTG TCCCAGCAGA TCACCTCTCC CATCTCTGGG ATCAATGGCG ACATTCGGGC AAAGAAGATT GCCAACATCA CAGACGTGTG TGAGTCTATG AAGGAGCAGC TGCTGGTCCT GGTCGAGTGG GCCAAGTACA TCCCGGCCTT CTGCGAACTC CTTCTGGATG ACCAGGTGGC GCTGCTCAGG GCCCACGCCG GTGAGCATCT GCTGCTTGGA GCCACCAAGA GGTCCATGGT GTTTAAGGAC GTGCTGCTCC TAGGCAATGA CTACATCGTC CCTCGGCACT GTCCAGAGCT AGCGGAGATG AGCCGTGTGT CCATCCGCAT CCTCGATGAG CTGGTCCTGC CCTTCCAAGA GCTGCAGATT GATGACAATG AATATGCCTG CCTCAAAGCC ATCATCTTCT TTGATCCAGA TGCCAAGGGG CTGAGTGACC CGGGCAAGAT CAAGCGGCTG CGGTCACAGG TGCAAGTGAG CCTGGAGGAT TACATCAACG ACCGGCAGTA CGACTCTCGG GGCCGCTTTG GAGAGCTGCT GCTGCTGTTG CCCACGCTGC AGAGCATCAC CTGGCAGATG ATCGAACAGA TCCAGTTCAT CAAGCTCTTC GGCATGGCCA AGATTGACAA CCTGCTGCAG GAGATGCTTC TCGGAGGGTC TGCCAGTGAT GCACCCCACA CCCACCACCC CCTGCACCCT CACCTGATGC AAGAACACAT GGGCACCAAT GTCATTGTTG CTAACACGAT GCCCTCTCAC CTCAGCAATG GACAGATGTG TGAGTGGCCC CGACCCAGGG GGCAGGCAGC CACTCCCGAG ACTCCACAGC CATCACCACC AAGTGGCTCG GGATCTGAAT CCTACAAGCT CCTGCCAGGA GCCATCACCA CCATCGTCAA GCCTCCCTCT GCCATTCCCC AGCCAACGAT CACCAAGCAA GAAGCCATCT AGCAAGCTGC TGGGGGGGTC AGGGGTTCTG CTGGCTCATA CCCTCAGAAG AGCACCTGGG AGTAACCTAG TCATGGCAAA GAAGATGTGA CACGAGGGAC CAGTCCCAGA GCAGCTACAG AAAGGGTGTG AGGCCCCAAA ACCGTGTGCT GAGGGGCGAA TGCGTCGCCA CCCCTGACCC CGCATCTGGA GGGCGGGGCT TTGCTTGAGA AGACCCCAGG GAGGACTGTC TTCCACTGCC TGGACTCCTC TCAAGTTGAA GTCATCGTCT TCATCTTCCT CCGTATCTTC TTCCCTCAAC TTCTTCACCC CTGAAGGACG ACTGTCTGCA GATGTTGCAG GACCTTGTTT TAAAATCAAC TCCCTTCTCT CCCAGCGGGG GGCCTCTTCC TTCCTGGTGC TGGTCAGGGG GCCTGGAAAC AAACTTTCTG AGGCTGGGTC AGCTTGCCTT ATAGTACTCC TCTCCTGCTA TGCCAACCTC AGGTGACCTG CTACCATCCT CTATACCTTC CTCCGCCATC TGACTTCTCT AAAGCCATCT CTCTGGAGGC TGAGGAAGCT GTGGTAACCA TTTCCCCACT CATTCTGAGA GCCTTCTGTA AGCACTGACC TGGGTAAGGC AGAGGGTAGG AGTCACCATC CCTCCTCTGC CAATATCGCT ACAACTCCTG CCTCCAGCAC TAGGCTATAA CTTTGGAGTG ATAAGTCCTA TGGCTTTCTA CAGTAGAGAA CCACCCAAGG GTGTCGATTA TAACAGAATG TGGAGAGTGG GTGGCCGTCA TTGGGAAAGC ATCGAGAAAG AGGCGAGCTT TGCATCTGTC CCTTGACAGG GAAGGTAGGC TTCTGGCTAG CAGAGCAGGT GACACAAACC AGTTTATTGG AGAACAGCCT GGACAAAGGC CCATAGGTAG GTAAAATAGT ATGGGAGGGA GGCAATGAAG AAATCAGTTC CCATGGAGTT GTGACAGGGT ACACACTGGG GACCATTGAA TGACAAACTG AGGTCAGGGG TAGCTGCAGT GTGGGGCTGT CAGAAGATGA ATACAGCATC CCGCAGAGGT AGGATATGAG GAGGCTATAC TGGAGCGTAG GGATGAGATA AAGGGATGGA TCCGAGTCCT CCCGGGGCCT GCCAAGCTTT TCCATACTTC CAGATGATGT TATAAGGCAT TAAACAGCCA CCATCGCATA GAACCTTCCC TGTAACCCAG ACATTGTCAA GGAAGATATA CGTAGAGGAT CTTAACTGAC TCACAGGAAG CACTTGTCCC CCCTGGCACG GAATCCAGAG GGTTCCTCGT CCTTTACCAG TGTCAACCCC AGAGGCTTTC TCTCTCCAGA ACTGGCCAGC TAGAGACCGT TCTAAAGTCC ACTGGAAGTC AAGAATCTCG TTTACTGATA ATAGTAAAGT TGATTCATGA CCCCTGTCCT TTTTTTTCTA CTGATCTACC CAAGTGTAGG TGAGCCGCAG CAGGGAGTGA TTCCTAGAAG ACGGATCAGT CTAGTCTGGC AGTCAAGGCT CAGGAGTTTG GGAGAGGGGC AGGAGAAGGA TAAGAAAGCC TGGGTTTTAG GCTTGCCTGG GAAGCTACAG TCAAGGTGCA TTCTGGGAGC TACTCATCCC CAGCAGTTAG CGCTCCGCCC CGGTTGACTC TTGATGGCTT TGCGGAGCCC CTGCAAAGTG TCACTAGTCA ATGGGAACAA GAGGAATGTC CCCTGGTCTG GAAGTGTGCT AAGTGGAAGG AATGGGCTGT GAGACTGGAT AGTTATGGTG CATCAAGGCT GATCCTTCTG ATTGGGTGGG GCGAGCATCC CAGTGTCCAA AAATTCCAGC CTAAATGACA GGTCCTCTGA AAAAGAGGTG CTGAGGAGTA ATGGGGCCAG CTGATTAAAG AAAAAGAACC CCCACACAAC AGGACTGTCA GGACAGATTG AGTTAACCCC TCAAGCCAAG TCCCGGGTGT CAGGAACAGT TGTCCATGCT CAGAGCCCTC AAGCCATCCT TGGCCACTCT CACTCCAGTG CCCCCCAGAG ACCCCAGCCA GATGGCTCAG ACTGTCCTGC ATGAAGGCAG GAGAGCTGAA CTCTCTCTGG TCCTTGTCTT TCCCAATCTT TGTCCCTCCA TCCCCAGTGG CATCAGGAGA GGAGTAGGTA ATGTTGGCCT TCAGTGGTAG CAGTCTTCTG GGGCAGGGGT CAGCCACTGT CCCAATCAGT CCTTTCTGAA GGAGAAACCC ATTCCACATT AACAAATTTA TTACAGTACA GGGAACATGG AATAAAGGAA AGTTTACTCT TCTGATTATA AGCTGAGGAT GCTATGTTGC AGTTTGTTTG CTTGTTTTTT TCTTCTGAGC TTTGTTTCTA GTACACGATA TGACGGGACC AAGTACAAGC TGGTGGTGGA CAGAGCTGGG TGCCACAGTT TTCCACCAAG AGCAGCCTCT TTTCTTCATG GAGTTCTCAG AACCTTTCAG GGTTCAGGAG GCTCCCCTGA GAATAGACAG GAGAGGGTCA GAAGCAGACG TCCTCCTTTT CTTGTGATAA CCACGCTACT TGCCTTTGCT AGAGCTCTCT GTGGCCAACC CTGGGAAATG CTAATCATGA CCTTCACACC AAACATTCAG AAGTAGGCTG TGTCCCATCA GATCAATCTG CACCTTCCTG TGGTTGTGCA AACATCACGG GGCCCTACCC TGATCCCCAA GGCCCCACCA TCACTGCCCA AGGGGGTAAA AAAGAGAAAA AGCCCTCAAA AACAGTTCTT ACTCCTGTGT TTTAGCAAAA ATTTATCAAA CAAAATAAAT GGTACTTATG TTTTCTAAAA AAAAAAAAAA A