Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T9351
Clone ID E9351
Template ID T9351
Template Origin Plasmid
Clone Image 6851153
Validity OK
Gene symbol Foxp2
Gene description Mus musculus forkhead box P2 (Foxp2), transcript variant 2, mRNA.
Gene Aliases CAG-16, D0Kist7, 2810043D05Rik
MGI ID MGI:2148705
Entrez Gene ID 114142
Ref Seq Accession NM_212435
Chromosome Location 6
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pYX-Asc
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD T3
Forward Primer Sequences ATTAACCCTCACTAAAGGGA
Reverse Primer RZPD T7
Reverse Primer Sequences TAATACGACTCACTATAGGG
Template Plate 106
Template Well E07
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC062926
TGU B
 Template Sequence
CTGATTTTGT GTACGAGTGT CCACGGACGC CAAAACAATC ACAGAGCTGC CTGATTTGTT TTAATTACCA GCACAAAATG CCATCAGTGT GGGACGTGAT CGGGCAGAGG TGTACTCACA GTAGTGTAAA TACTGCTGTA AACAGTTGCC TGATGGTGGC TTTGACAGTG AGCTAGCTTC GGAGTTTTTC CTTCTTTTTA GACTGTTTTT CCCCCCCCGC ACTGGCTTTT TGAATCTTCT TAATTTTTCA TCTCTCTAAC AAACTCCTAT GAAGTTGAAA CCGGGAAGTT TGCTCTAACA TTTCCAGAGA AGGTATTAAG TCATGATGCA GGAATCTGCG ACAGAGACAA TAAGCAACAG TTCAATGAAT CAAAATGGAA TGAGCACTTT AAGCAGCCAA TTAGATGCTG GCAGCAGGGA TGGGAGATCA AGTGGTGACA CCAGCTCTGA AGTAAGCACA GTGGAGCTGC TGCATCTGCA ACAACAGCAG GCTCTCCAGG CAGCAAGACA ACTTTTGTTA CAGCAGCAAA CCAGTGGATT GAAATCTCCT AAGAGCAGTG AGAAGCAGAG GCCACTGCAG GTGCCCGTGT CGGTGGCCAT GATGACTCCC CAAGTGATCA CCCCTCAGCA GATGCAGCAG ATTCTTCAGC AGCAGGTCCT GTCTCCTCAG CAGCTCCAGG CCCTCCTCCA GCAGCAGCAA GCTGTGATGT TGCAGCAGCA ACAACTACAA GAGTTTTACA AGAAACAGCA AGAACAGTTA CATCTTCAGC TTTTGCAACA GCAGCAACAG CAGCAGCAGC AACAGCAGCA ACAGCAGCAG CAGCAGCAGC AACAACAGCA GCAGCAGCAG CAACAGCAAC AGCAGCAGCA GCAACAGCAG CAGCAACAGC AACAGCATCC TGGAAAGCAA GCAAAAGAGC AGCAGCAGCA ACAGCAGCAG CAGCAGTTGG CGGCGCAGCA GCTCGTCTTC CAGCAGCAGC TTCTCCAAAT GCAGCAGCTA CAGCAGCAAC AACATCTGCT CAGCCTTCAG CGCCAGGGCC TCATCTCCAT CCCACCCGGC CAAGCAGCCC TTCCTGTCCA GTCGCTGCCT CAAGCTGGCT TAAGTCCTGC TGAGATTCAG CAACTATGGA AAGAAGTGAC TGGAGTCCAT AGTATGGAAG ACAACGGCAT CAAGCATGGA GGGCTAGACC TCACGACTAA CAATTCCTCC TCGACTACCT CCTCCACCAC GTCCAAAGCA TCACCACCCA TCACACATCA TTCCATAGTG AACGGACAGT CTTCAGTTCT GAATGCAAGG CGGGACAGCT CATCACATGA GGAGACTGGG GCCTCGCACA CTCTCTATGG CCATGGAGTC TGCAAGTGGC CAGGCTGTGA AAGCATATGT GAAGATTTTG GACAGTTTTT GAAGCACCTT AACAATGAGC ATGCATTGGA TGACCGAAGC ACTGCCCAAT GTCGAGTGCA AATGCAGGTG GTACAGCAGT TAGAAATACA GCTTTCTAAG GAACGCGAAC GTCTTCAAGC GATGATGACC CACTTGCACA TGCGACCCTC AGAGCCCAAA CCATCTCCCA AACCTCTAAA TCTGGTGTCT AGTGTCACCA TGTCGAAGAA CATGCTGGAG ACATCCCCAC AGAGCTTACC TCAAACCCCT ACCACACCAA CGGCCCCAGT CACCCCGATT ACCCAGGGAC CCTCTGTAAT CACCCCAGCC AGTGTGCCCA ATGTGGGAGC CATACGAAGG CGACATTCAG ACAAATACAA CATCCCCATG TCATCAGAGA TTGCCCCAAA CTACGAATTT TATAAAAACG CAGATGTTAG ACCTCCCTTC ACTTATGCAA CACTCATAAG GCAGGCTATC ATGGAGTCAT CTGACAGGCA GTTAACACTT AATGAAATTT ACAGCTGGTT TACACGGACA TTTGCTTACT TCAGGCGGAA TGCCGCCACT TGGAAGAATG CAGTGCGTCA TAATCTTAGC CTGCACAAAT GTTTTGTTCG AGTAGAAAAT GTTAAAGGAG CAGTGTGGAC TGTGGACGAA GTCGAATACC AGAAGCGAAG GTCACAAAAG ATAACAGGAA GTCCAACTTT AGTAAAAAAT ATACCTACAA GTTTGGGCTA TGGAGCAGCT CTAAATGCCA GTCTGCAGGC TGCCTTGGCA GAAAGCAGCT TGCCTTTGCT AAGTAACCCT GGACTGATCA ATAACGCCTC CAGTGGCCTC CTGCAGGCCG TCCACGAAGA CCTCAATGGT TCCCTGGACC ACATCGACAG CAATGGGAAC AGCAGTCCGG GTTGCTCACC TCAGCCACAC ATACATTCAA TCCATGTCAA GGAAGAACCC GTGATTGCAG AGGATGAAGA CTGTCCAATG TCATTAGTGA CAACAGCCAA TCACAGTCCG GAGTTAGAAG ATGACAGAGA GATTGAGGAA GAGCCTTTAT CTGAGGACCT GGAATGAGAA CGAACTTGTG ACACCTCAGT GTGAAGGGAC ATATCACTGA CCTTCATAAC CACTCCACAA CCATGAATAG TTGACAAATT TTTACTGTGA CTATTTATTA AGCATGGATA AAGGAGACAG CCCTAAAGGA ACTTACTAAG CCAGCCCTTT GGGATTCAGA ACCAACAGGC AAATTGCTTG TTTTCTTCTC TTTCTGTCCT TATTTTGTTT GTTTGTTTGT TTGATTTTAC TTTCTTTACT TATTTTCTTT TTTTCATTTT TTTAAAGGCA AAAAAAAAAA CTGATTTTCT TGGGAAAAGA GAGAAAGAAC TGTTCTTTCT ATAATGGCTT TGCCCATTTA AAAAATGTGG CTCTCAAGGG TTCATGAAAT GACTGAGTAT GAGGATCCAT GTCCTATAGA AAGCAACTGC GCCTCATATA CTGCCAAAAA TAGTGTTAGT TTCATTAATG TGAATTTTCC AGCATTCAGT AGTCGTAATG TTAGAAACAA TTGCTGGTCA AGTTCAACTT GTTGCTATTG TTTTTAATTT GCACAGGAGT AGTATCAGAA ATTAGTGTCA CTGCTTGTAT CTAGCTGACT TTTAAACAAC AGAACATTAG TTTTTTATGT TGGTGCCACC AACTGTAAAT GACATAAGTT AGTTATTACA AAACACAGTA ATTAGACTGT TGCAACCATC TAAAACCTTA GGCTTCCAGT CTGTGCTGTT AGTGTAAAGA TGTAAAGTGC AATCCTAAGC TAACATTATC TGTGCAAGCA CCATAGAAAC ATTTGCATAT CTGCATAGAT CTTACAACTG TACTCTTTAC CTCCTTGTGA TAAAGCTTTG TCTACCTGCA AACACAGTCA AAGGCTACAG CTGCAAACCA AAGCCAACTC TAACCATGGC CAAGAGCTCA AGGACAGAAG CAGCCACATG CTTTGGTCAG CCTTCTGTAA CTTCAATTAG TACAAAGGAA CCTTTTCCAT GAACTACCTG CTGTTTTCTG ATGACCTCTG GGATCTTTTC ATTTAGCCCT AAACAAAGAA ACGAATATGA CAAAACAAAA ACAAAAAAAC AACCCACAAC TAAGAGTTCA TTCAGTCACA GAGTAATCTT CTGAGGCCAA AAGTCCATCT AAATGCAATG AAGATTTGCT TTCATTAAAG ACAGAGGTGA GGACAAAATC TGCAGTGGAA GTTATGACAC TCTAGAAAGC AACAAATGTG GATCACTGAC CAAAACAATT ATGTACTTGA TGCAAATGCA GATTGCGTAT TGTTATATAT ATAGTACATT GCGTTTTTGT TTTCCCCATC TTTTTGGTGG TGAGTTCATG TTGTTAGAAG TACATGTCTT GTATGGTCTT AATCTCTGTT GTGTACTATT TTTTTATAGT CTTAAGTTAT AATAAAAAAA AACAAAAAAC AAAAAACAAA AAGTAGGAAC CAAACATAAA AGGTCTAGTA AAGCCAAAAA TTAATTTCCT ATTGATTTTA AAGTGATCTA GCTGAGTTTT TACACTGAAA GCAAAGATTA TAGCAAGTGT AGCCCATGGT ATTTATTTTC AGTCAAACCA AAGTTACATA TAATTCTGCC TCTGCTTATA CGGGATATGA ACACTAACAC ACTCCCTTCA AAGACTTGTG CAGGCCAAAT TGTTGGAATG CTGATTTTCT TGACAACTCT AAACCCCAAA ACTATGATAA GACGTTATGG TGTAGTTGAA GATAGCATAG TCAGATGTTT GCTTAAAACC TAGAGACTTT ATGTGTTGCT TTTCATGTGC TGTGCCAAGT CTTGATAATA CTTTTTCCCC CAACCAAGGG ACCTCATAAC CTGATTATGG TTATTGCTTT ACAAACAGTT TTGACAGAAG GTGGCTGCTA GAGCTTAACA AATGTCCCGG TTCCATGTGA TGGAGCCGGT TCTTGCAAAC TAAGCTCAAT GTTTATCCTT TGCTGAAGTC AGCAAATAGA GTTAGAGAGA TACCCAGTCA TCTATCACAC CAAATAAAAG GACATAACGG CTTTCAAAGG GTTTTCCCAC TTACCCAAAA GGCTTTCTGA AAGCTTCTAC CTCTGCAAAA AAAAAAAAAG AAAAAAAAAA AAAAAAAA