Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T165
Clone ID E165
Template ID T165
Template Origin Plasmid
Clone Image 2645295
Validity OK
Gene symbol Sox8
Gene description SRY-box containing gene 8 (Sox8)
Gene Aliases  
MGI ID MGI:98370
Entrez Gene ID 20681
Ref Seq Accession NM_011447
Chromosome Location 17
ENSEMBL Transcript ID ENSMUST00000025003
ENSEMBL Gene ID ENSMUSG00000024176
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 2
Template Well G12
Template Group  
Template Sequence Status Partial
Template Sequence ID 2645295_r1AW229842BX
TGU B
 Template Sequence