Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T1654
Clone ID E1654
Template ID T1654
Template Origin Plasmid
Clone Image 463700
Validity OK
Gene symbol Rgs19
Gene description regulator of G-protein signaling 19 (Rgs19)
Gene Aliases GAIP, 2610042F04Rik
MGI ID MGI:1915153
Entrez Gene ID 56470
Ref Seq Accession NM_026446
Chromosome Location 2
ENSEMBL Transcript ID ENSMUST00000002532
ENSEMBL Gene ID ENSMUSG00000002458
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 19
Template Well D02
Template Group  
Template Sequence Status Partial
Template Sequence ID 463700_r1AI322397BX5
TGU B
 Template Sequence