Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T1761
Clone ID E1761
Template ID T1761
Template Origin Plasmid
Clone Image 483498
Validity OK
Gene symbol Crygs
Gene description crystallin, gamma S (Crygs)
Gene Aliases Opj, rncat
MGI ID MGI:1298216
Entrez Gene ID 12970
Ref Seq Accession NM_009967
Chromosome Location 16
ENSEMBL Transcript ID ENSMUST00000040592
ENSEMBL Gene ID ENSMUSG00000033501
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 20
Template Well E01
Template Group  
Template Sequence Status Partial
Template Sequence ID 483498_r1AI893668BX5
TGU B
 Template Sequence