Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T1777
Clone ID E1777
Template ID T1777
Template Origin Plasmid
Clone Image 493457
Validity OK
Gene symbol Msc
Gene description musculin (Msc)
Gene Aliases MyoR
MGI ID MGI:1333884
Entrez Gene ID 17681
Ref Seq Accession NM_010827
Chromosome Location 1
ENSEMBL Transcript ID ENSMUST00000027062
ENSEMBL Gene ID ENSMUSG00000025930
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 20
Template Well F05
Template Group  
Template Sequence Status Partial
Template Sequence ID 493457_r1AI595213BX5
TGU B
 Template Sequence