Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T1865
Clone ID E1865
Template ID T1865
Template Origin Plasmid
Clone Image 596225
Validity OK
Gene symbol Grem1
Gene description gremlin 1 (Grem1)
Gene Aliases ld, Drm, gremlin, Cktsf1b1
MGI ID MGI:1344337
Entrez Gene ID 23892
Ref Seq Accession NM_011824
Chromosome Location 2
ENSEMBL Transcript ID ENSMUST00000052960
ENSEMBL Gene ID ENSMUSG00000047926
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 21
Template Well E09
Template Group  
Template Sequence Status Partial
Template Sequence ID 596225_r1AI536167BX5
TGU B
 Template Sequence