Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T2177
Clone ID E2177
Template ID T2177
Template Origin Plasmid
Clone Image 890642
Validity OK
Gene symbol Scarf1
Gene description scavenger receptor class F, member 1 (Scarf1)
Gene Aliases KIA, MGC, SREC, SREC-I, mKIAA0149
MGI ID MGI:2449455
Entrez Gene ID 380713
Ref Seq Accession NM_001004157
Chromosome Location 11
ENSEMBL Transcript ID NA
ENSEMBL Gene ID NA
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 24
Template Well G09
Template Group  
Template Sequence Status Partial
Template Sequence ID 890642_r1BX518407A50
TGU M
 Template Sequence