Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T2527
Clone ID E2527
Template ID T2527
Template Origin Plasmid
Clone Image 1381873
Validity OK
Gene symbol Plrg1
Gene description pleiotropic regulator 1, PRL1 homolog (Arabidopsis) (Plrg1)
Gene Aliases  
MGI ID MGI:1858197
Entrez Gene ID 53317
Ref Seq Accession NM_016784
Chromosome Location 3
ENSEMBL Transcript ID ENSMUST00000029628
ENSEMBL Gene ID ENSMUSG00000027998
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 28
Template Well D11
Template Group  
Template Sequence Status Partial
Template Sequence ID 1381873_r1AA833388BX
TGU M
 Template Sequence