Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T2579
Clone ID E2579
Template ID T2579
Template Origin Plasmid
Clone Image 1383221
Validity OK
Gene symbol Slc16a2
Gene description solute carrier family 16 (monocarboxylic acid transporters), member 2 (Slc16a2)
Gene Aliases Mct8, Xpct
MGI ID MGI:1203732
Entrez Gene ID 20502
Ref Seq Accession NM_009197
Chromosome Location X
ENSEMBL Transcript ID ENSMUST00000042664
ENSEMBL Gene ID ENSMUSG00000033965
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 29
Template Well A03
Template Group  
Template Sequence Status Partial
Template Sequence ID 1383221_r1AI120807BX
TGU M
 Template Sequence