Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T2593
Clone ID E2593
Template ID T2593
Template Origin Plasmid
Clone Image 1383666
Validity OK
Gene symbol Rb1
Gene description retinoblastoma 1 (Rb1)
Gene Aliases Rb, pRb, Rb-1
MGI ID MGI:97874
Entrez Gene ID 19645
Ref Seq Accession NM_009029
Chromosome Location 14
ENSEMBL Transcript ID ENSMUST00000022701
ENSEMBL Gene ID ENSMUSG00000022105
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 29
Template Well B05
Template Group  
Template Sequence Status Partial
Template Sequence ID 1383666_r1AI180786BX
TGU M
 Template Sequence