Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T2771
Clone ID E2771
Template ID T2771
Template Origin Plasmid
Clone Image 1514901
Validity OK
Gene symbol Gosr2
Gene description golgi SNAP receptor complex member 2 (Gosr2)
Gene Aliases Gs27, SNARE, membrin, 2310032N09Rik
MGI ID MGI:1927204
Entrez Gene ID 56494
Ref Seq Accession NM_019650
Chromosome Location 11
ENSEMBL Transcript ID ENSMUST00000021329
ENSEMBL Gene ID ENSMUSG00000020946
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 31
Template Well A03
Template Group  
Template Sequence Status Partial
Template Sequence ID 1514901_r1AW913303BX
TGU M
 Template Sequence