Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T2835
Clone ID E2835
Template ID T2835
Template Origin Plasmid
Clone Image 1528819
Validity OK
Gene symbol Wbp2
Gene description WW domain binding protein 2 (Wbp2)
Gene Aliases  
MGI ID MGI:104709
Entrez Gene ID 22378
Ref Seq Accession NM_016852
Chromosome Location 11
ENSEMBL Transcript ID ENSMUST00000073019
ENSEMBL Gene ID ENSMUSG00000034341
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 31
Template Well F07
Template Group  
Template Sequence Status Partial
Template Sequence ID 1528819_r1AW985674BX
TGU M
 Template Sequence