Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T30002
Clone ID E30002
Template ID T30002
Template Origin Plasmid
Clone Image 3494644
Validity OK
Gene symbol Ehf
Gene description ets homologous factor
Gene Aliases 9030625L19Rik, AU019492
MGI ID MGI:1270840
Entrez Gene ID 13661
Ref Seq Accession NM_007914
Chromosome Location 2
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter SP6
Sense Promoter  
Forward Primer 014057_F_IRAV12-15_A16_Ehf
Forward Primer Sequences CCCTGTCTTTCCCTGGCT
Reverse Primer 014057_R_SP6_IRAV12-15_A16_Ehf
Reverse Primer Sequences GCGATTTAGGTGACACTATAGTCCTGTTGCATCCCAGGT
Template Plate 500-TEM
Template Well C1
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU B
 Template Sequence