Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T30013
Clone ID E30013
Template ID T30013
Template Origin Plasmid
Clone Image 3601768
Validity OK
Gene symbol Foxi1
Gene description forkhead box I1
Gene Aliases 5830401E05Rik, FREAC6, Fkh10, HFH-3
MGI ID MGI:1096329
Entrez Gene ID 14233
Ref Seq Accession NM_023907
Chromosome Location 11
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter SP6
Sense Promoter  
Forward Primer 012084_F_IRAV12-15_F02_Foxi1
Forward Primer Sequences CACCAGCTCCCCAGAGAA
Reverse Primer 012084_R_SP6_IRAV12-15_F02_Foxi1
Reverse Primer Sequences GCGATTTAGGTGACACTATAGAAGAAAAGGCAGGTGGGG
Template Plate 500-TEM
Template Well F2
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU B
 Template Sequence