Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T30109
Clone ID E30109
Template ID T30109
Template Origin Plasmid
Clone Image 4218741
Validity OK
Gene symbol Spdef
Gene description SAM pointed domain containing ets transcription factor
Gene Aliases PDEF, Pse
MGI ID MGI:1353422
Entrez Gene ID 30051
Ref Seq Accession NM_013891
Chromosome Location 17
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter SP6
Sense Promoter  
Forward Primer 016710_F_IRAV24-27_C03_Spdef
Forward Primer Sequences CGACGATAGCAGCTGGGT
Reverse Primer 016710_R_SP6_IRAV24-27_C03_Spdef
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGATCTTCCTGGGGCCTGT
Template Plate 501-TEM
Template Well F2
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU B
 Template Sequence