Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T30112
Clone ID E30112
Template ID T30112
Template Origin Plasmid
Clone Image 3675437
Validity OK
Gene symbol Sox10
Gene description SRY-box containing gene 10
Gene Aliases Dom, Sox21
MGI ID MGI:98358
Entrez Gene ID 20665
Ref Seq Accession XM_985075
Chromosome Location 15
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter SP6
Sense Promoter  
Forward Primer 017490_F_IRAV24-27_E06_Sox10
Forward Primer Sequences AGAAGGCTCCCCCATGTC
Reverse Primer 017490_R_SP6_IRAV24-27_E06_Sox10
Reverse Primer Sequences GCGATTTAGGTGACACTATAGTGCTGCTGTCAGCCTCTG
Template Plate 501-TEM
Template Well A3
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU B
 Template Sequence