Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T30131
Clone ID E30131
Template ID T30131
Template Origin Plasmid
Clone Image 4207456
Validity OK
Gene symbol Hoxb13
Gene description homeo box B13
Gene Aliases  
MGI ID MGI:107730
Entrez Gene ID 15408
Ref Seq Accession NM_008267
Chromosome Location 11
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter SP6
Sense Promoter  
Forward Primer 018187_F_IRAV28-31_G11_Hoxb13
Forward Primer Sequences CAACGCTGATGCCAACTG
Reverse Primer 018187_R_SP6_IRAV28-31_G11_Hoxb13
Reverse Primer Sequences GCGATTTAGGTGACACTATAGCACATGCAGGATAGCCCC
Template Plate 501-TEM
Template Well D5
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU B
 Template Sequence