Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T30147
Clone ID E30147
Template ID T30147
Template Origin Plasmid
Clone Image 4211437
Validity OK
Gene symbol Wnt5b
Gene description wingless-related MMTV integration site 5B
Gene Aliases AW545702, Wnt-5b
MGI ID MGI:98959
Entrez Gene ID 22419
Ref Seq Accession NM_009525
Chromosome Location 6
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter SP6
Sense Promoter  
Forward Primer 018192_F_IRAV28-31_O01_Wnt5b
Forward Primer Sequences AGTGACTGCACCACACGG
Reverse Primer 018192_R_SP6_IRAV28-31_O01_Wnt5b
Reverse Primer Sequences GCGATTTAGGTGACACTATAGACCTGCTAGCATGCCCTG
Template Plate 501-TEM
Template Well D7
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU B
 Template Sequence