Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T30355
Clone ID E30355
Template ID T30355
Template Origin Plasmid
Clone Image 6468233
Validity OK
Gene symbol Mapk1
Gene description mitogen activated protein kinase 1
Gene Aliases 9030612K14Rik, AA407128, AU018647, C78273, ERK, Erk2, MAPK2, PRKM2, Prkm1, p41mapk, p42mapk
MGI ID MGI:1346858
Entrez Gene ID 26413
Ref Seq Accession NM_011949
Chromosome Location 16
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter SP6
Sense Promoter  
Forward Primer 059364_F_IRAV100_b02_Mapk1
Forward Primer Sequences TTGCTTTCTCTCCCGCAC
Reverse Primer 059364_R_SP6_IRAV100_b02_Mapk1
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGCTGGTGCAATGCTTCCT
Template Plate 503-TEM
Template Well D9
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU B
 Template Sequence