Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T30383
Clone ID E30383
Template ID T30383
Template Origin Plasmid
Clone Image 6389756
Validity OK
Gene symbol Zfp406
Gene description zinc finger protein 406
Gene Aliases Gm922, MGC56951
MGI ID MGI:2681865
Entrez Gene ID 380993
Ref Seq Accession NM_198644
Chromosome Location 15
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter SP6
Sense Promoter  
Forward Primer 058351_F_IRAV102_c11_Zfp406
Forward Primer Sequences TGTACGCAAGGAGGAGGC
Reverse Primer 058351_R_SP6_IRAV102_c11_Zfp406
Reverse Primer Sequences GCGATTTAGGTGACACTATAGAGTGGGGCACTTCAGCAA
Template Plate 503-TEM
Template Well H12
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU B
 Template Sequence