Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T30899
Clone ID E30899
Template ID T30899
Template Origin Plasmid
Clone Image 3981950
Validity OK
Gene symbol Cox15
Gene description COX15 homolog, cytochrome c oxidase assembly protein (yeast)
Gene Aliases 2900026G05Rik, MGC18952
MGI ID MGI:1920112
Entrez Gene ID 226139
Ref Seq Accession NM_144874
Chromosome Location 19
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter SP6
Sense Promoter  
Forward Primer 018851_F_IRAV24-27_K20_Cox15
Forward Primer Sequences AAGTGGCTCTGCAATCCG
Reverse Primer 018851_R_SP6_IRAV24-27_K20_Cox15
Reverse Primer Sequences GCGATTTAGGTGACACTATAGTTCGAGGAAGGGGGATTC
Template Plate 509-TEM
Template Well D5
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU B
 Template Sequence