Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T30908
Clone ID E30908
Template ID T30908
Template Origin Plasmid
Clone Image 4019334
Validity OK
Gene symbol Ift88
Gene description intraflagellar transport 88 homolog (Chlamydomonas)
Gene Aliases AW552028, Tg737, Tg737Rpw, TgN737Rpw, Ttc10, flexo, fxo, orpk, polaris
MGI ID MGI:98715
Entrez Gene ID 21821
Ref Seq Accession NM_009376
Chromosome Location 14
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter SP6
Sense Promoter  
Forward Primer 017710_F_IRAV24-27_L23_Tg737Rpw
Forward Primer Sequences AGCGTCTTTTGCTGTGGG
Reverse Primer 017710_R_SP6_IRAV24-27_L23_Tg737Rpw
Reverse Primer Sequences GCGATTTAGGTGACACTATAGCCATCAGCTGCCACTTCA
Template Plate 509-TEM
Template Well E6
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU B
 Template Sequence