Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T31197
Clone ID E31197
Template ID T31197
Template Origin Plasmid
Clone Image 3983436
Validity OK
Gene symbol Klhdc3
Gene description kelch domain containing 3
Gene Aliases 1300011D16Rik, Peas
MGI ID MGI:2651568
Entrez Gene ID 71765
Ref Seq Accession NM_027910
Chromosome Location 17
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter SP6
Sense Promoter  
Forward Primer 054763_F_IRAV47_f05_Klhdc3
Forward Primer Sequences CAATGCTGTGTCCTTGCG
Reverse Primer 054763_R_SP6_IRAV47_f05_Klhdc3
Reverse Primer Sequences GCGATTTAGGTGACACTATAGCTGAATCACCGCCAGCTT
Template Plate 512-TEM
Template Well F6
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU B
 Template Sequence