Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T31456
Clone ID E31456
Template ID T31456
Template Origin Plasmid
Clone Image 5066822
Validity OK
Gene symbol Sec63
Gene description SEC63-like (S. cerevisiae)
Gene Aliases 5730478J10Rik, AI649014, AW319215
MGI ID MGI:2155302
Entrez Gene ID 140740
Ref Seq Accession NM_153055
Chromosome Location 10
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter SP6
Sense Promoter  
Forward Primer 025736_F_IRAV59-62_K10_Sec63
Forward Primer Sequences GGAGCAGCCCACAGAAGA
Reverse Primer 025736_R_SP6_IRAV59-62_K10_Sec63
Reverse Primer Sequences GCGATTTAGGTGACACTATAGATCAGCCCTCACTGCTGC
Template Plate 515-TEM
Template Well A3
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU B
 Template Sequence