Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T31531
Clone ID E31531
Template ID T31531
Template Origin Plasmid
Clone Image 5353938
Validity OK
Gene symbol Tia1
Gene description cytotoxic granule-associated RNA binding protein 1
Gene Aliases 2310050N03Rik, AI256674, mTIA-1
MGI ID MGI:107914
Entrez Gene ID 21841
Ref Seq Accession NM_011585
Chromosome Location 6
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter SP6
Sense Promoter  
Forward Primer 028394_F_IRAV67-70_F21_Tia1
Forward Primer Sequences GAAAGCCTCCAGCTCCAA
Reverse Primer 028394_R_SP6_IRAV67-70_F21_Tia1
Reverse Primer Sequences GCGATTTAGGTGACACTATAGCATTGTGCAATTTTCTGCCT
Template Plate 515-TEM
Template Well D12
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU B
 Template Sequence