Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T3160
Clone ID E3160
Template ID T3160
Template Origin Plasmid
Clone Image 1548179
Validity HOLD
Gene symbol Irx2
Gene description Iroquois related homeobox 2 (Drosophila) (Irx2)
Gene Aliases MGC, IRX6
MGI ID MGI:1197526
Entrez Gene ID 16372
Ref Seq Accession NM_010574
Chromosome Location 13
ENSEMBL Transcript ID ENSMUST00000076057
ENSEMBL Gene ID ENSMUSG00000001504
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 35
Template Well A08
Template Group  
Template Sequence Status Partial
Template Sequence ID 1548179_r1BE198137BX
TGU B
 Template Sequence