Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T31630
Clone ID E31630
Template ID T31630
Template Origin Plasmid
Clone Image 2647494
Validity OK
Gene symbol Smarcd2
Gene description SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
Gene Aliases AW322457, Baf60b
MGI ID MGI:1933621
Entrez Gene ID 83796
Ref Seq Accession NM_031878
Chromosome Location 11
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter SP6
Sense Promoter  
Forward Primer 013039_F_IRAV08-11_D05_Smarcd2
Forward Primer Sequences AGCCCCAGGACTTCATCC
Reverse Primer 013039_R_SP6_IRAV08-11_D05_Smarcd2
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGCAGCCGCTTGCATAGAT
Template Plate 516-TEM
Template Well G12
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU B
 Template Sequence