Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T31862
Clone ID E31862
Template ID T31862
Template Origin Plasmid
Clone Image 6706223
Validity OK
Gene symbol AI591476
Gene description expressed sequence AI591476
Gene Aliases C820002C15, Jaz1, Tip27
MGI ID MGI:2141450
Entrez Gene ID 231986
Ref Seq Accession NM_173406
Chromosome Location 6
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter SP6
Sense Promoter  
Forward Primer 061091_F_IRAW2_e06_AI591476
Forward Primer Sequences CTGCAGCAGCCGACCTAT
Reverse Primer 061091_R_SP6_IRAW2_e06_AI591476
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGCTGAGTGCTTCCCCTGA
Template Plate 520-TEM
Template Well F5
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU B
 Template Sequence