Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T32023
Clone ID E32023
Template ID T32023
Template Origin Plasmid
Clone Image 4461061
Validity OK
Gene symbol Rgs12
Gene description regulator of G-protein signaling 12
Gene Aliases 1200016K18Rik, 4632412M04Rik, AI481290, E130309H11
MGI ID MGI:1918979
Entrez Gene ID 71729
Ref Seq Accession NM_173402
Chromosome Location 5
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter SP6
Sense Promoter  
Forward Primer 020420_F_IRAV55-58_A24_Rgs12
Forward Primer Sequences CAACAGCCTGAGCAGCAA
Reverse Primer 020420_R_SP6_IRAV55-58_A24_Rgs12
Reverse Primer Sequences GCGATTTAGGTGACACTATAGTTTGATGGAGAACCCGGA
Template Plate 522-TEM
Template Well G9
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU B
 Template Sequence