Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T32069
Clone ID E32069
Template ID T32069
Template Origin Plasmid
Clone Image 4039558
Validity OK
Gene symbol Dnajb9
Gene description DnaJ (Hsp40) homolog, subfamily B, member 9
Gene Aliases AA408011, AA673251, AA673481, AW556981, ERdj4, Mdg1, mDj7
MGI ID MGI:1351618
Entrez Gene ID 27362
Ref Seq Accession NM_013760
Chromosome Location 12
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter SP6
Sense Promoter  
Forward Primer 060644_F_IRAV89_f09_Dnajb9
Forward Primer Sequences ATCCTGGCCTCCAAAAGC
Reverse Primer 060644_R_SP6_IRAV89_f09_Dnajb9
Reverse Primer Sequences GCGATTTAGGTGACACTATAGCAATCCGCCTCCAAAAGA
Template Plate 523-TEM
Template Well E3
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU B
 Template Sequence