Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T35444
Clone ID E35444
Template ID T35444
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Foxo1
Gene description forkhead box O1
Gene Aliases AI876417, Afxh, FKHR, Fkhr1, Foxo1a
MGI ID MGI:1890077
Entrez Gene ID 56458
Ref Seq Accession NM_019739
Chromosome Location 3
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 095919_F_cDNA_Foxo1
Forward Primer Sequences TGCTCAGCTGGTTTGTACACTT
Reverse Primer 095919_N_SP6_cDNA_Foxo1
Reverse Primer Sequences GCGATTTAGGTGACACTATAGTTAACTAATCCTGCCACTGTCTG
Template Plate 10006_TEM
Template Well 10006_TEM_G10
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence