Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T35470
Clone ID E35470
Template ID T35470
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Irf5
Gene description interferon regulatory factor 5
Gene Aliases AW491843, mirf5
MGI ID MGI:1350924
Entrez Gene ID 27056
Ref Seq Accession NM_012057
Chromosome Location 6
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 074637_F_cDNA_Irf5
Forward Primer Sequences CACTGATGATTACGTTCTGGGA
Reverse Primer 074637_N_SP6_cDNA_Irf5
Reverse Primer Sequences GCGATTTAGGTGACACTATAGTGAGCTCATTGAGAAACTGCT
Template Plate 10007_TEM
Template Well 10007_TEM_C02
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence