Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T35471
Clone ID E35471
Template ID T35471
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Irx4
Gene description Iroquois related homeobox 4 (Drosophila)
Gene Aliases  
MGI ID MGI:1355275
Entrez Gene ID 50916
Ref Seq Accession NM_018885
Chromosome Location 13
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 074902_F_cDNA_Irx4
Forward Primer Sequences TGGATAGTGGACCAGAGAGGAT
Reverse Primer 074902_N_SP6_cDNA_Irx4
Reverse Primer Sequences GCGATTTAGGTGACACTATAGTGTGCTCTCCGGTCTTCTCAT
Template Plate 10007_TEM
Template Well 10007_TEM_C03
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence