Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T35495
Clone ID E35495
Template ID T35495
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Myt1l
Gene description myelin transcription factor 1-like
Gene Aliases 2900046C06Rik, 2900093J19Rik, C630034G21Rik, Nztf1, Pmng1, Png-1, mKIAA1106
MGI ID MGI:1100511
Entrez Gene ID 17933
Ref Seq Accession NM_008666
Chromosome Location 12
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 100884_F_cDNA_Myt1l
Forward Primer Sequences ACTACACACATGACATGGAGGC
Reverse Primer 100884_N_SP6_cDNA_Myt1l
Reverse Primer Sequences GCGATTTAGGTGACACTATAGACCCAGAAAGGCTTCGATGAG
Template Plate 10007_TEM
Template Well 10007_TEM_F05
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence