Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T35534
Clone ID E35534
Template ID T35534
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Six6
Gene description sine oculis-related homeobox 6 homolog (Drosophila)
Gene Aliases Optx2, Six9
MGI ID MGI:1341840
Entrez Gene ID 20476
Ref Seq Accession NM_011384
Chromosome Location 12
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 071152_F_cDNA_Six6
Forward Primer Sequences ACGTGAGAAAGGGCTGATGTAT
Reverse Primer 071152_N_SP6_cDNA_Six6
Reverse Primer Sequences GCGATTTAGGTGACACTATAGCACCTTGTAGACCAGGCTGAC
Template Plate 10008_TEM
Template Well 10008_TEM_B11
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence