Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T35535
Clone ID E35535
Template ID T35535
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Smad1
Gene description MAD homolog 1 (Drosophila)
Gene Aliases AI528653, Madh1, Madr1, Mlp1, MusMLP
MGI ID MGI:109452
Entrez Gene ID 17125
Ref Seq Accession NM_008539
Chromosome Location 8
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 096594_F_cDNA_Smad1
Forward Primer Sequences TGCATGTACTTGAAGGATGGAC
Reverse Primer 096594_N_SP6_cDNA_Smad1
Reverse Primer Sequences GCGATTTAGGTGACACTATAGATACTGGGTACTGAAACACGAAG
Template Plate 10008_TEM
Template Well 10008_TEM_C01
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence