Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T35889
Clone ID E35889
Template ID T35889
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Adamts8
Gene description a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8
Gene Aliases METH-2, METH2
MGI ID MGI:1353468
Entrez Gene ID 30806
Ref Seq Accession NM_013906
Chromosome Location 9
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 099944_F_cDNA_Adamts8
Forward Primer Sequences TGTGTACTCAAGGAGGATGTGG
Reverse Primer 099944_N_SP6_cDNA_Adamts8
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGTTGCTCTTTCCTTGCTATTCTG
Template Plate 10014_TEM
Template Well 10014_TEM_D04
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence