Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T35928
Clone ID E35928
Template ID T35928
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Amh
Gene description anti-Mullerian hormone
Gene Aliases MIS
MGI ID MGI:88006
Entrez Gene ID 11705
Ref Seq Accession NM_007445
Chromosome Location 10
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 097354_F_cDNA_Amh
Forward Primer Sequences TGCTAGTCCTACATCTGGCTGA
Reverse Primer 097354_N_SP6_cDNA_Amh
Reverse Primer Sequences GCGATTTAGGTGACACTATAGACCAAGCGAGTGAGGGTCTCT
Template Plate 10015_TEM
Template Well 10015_TEM_B10
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU  
 Template Sequence