Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T36061
Clone ID E36061
Template ID T36061
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Btc
Gene description betacellulin, epidermal growth factor family member
Gene Aliases  
MGI ID MGI:99439
Entrez Gene ID 12223
Ref Seq Accession NM_007568
Chromosome Location 5
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 071057_F_cDNA_Btc
Forward Primer Sequences GATATGGACCCAGAGTCAAAGC
Reverse Primer 071057_N_SP6_cDNA_Btc
Reverse Primer Sequences GCGATTTAGGTGACACTATAGATGTAGTCAAAGGACCACAAGAG
Template Plate 10017_TEM
Template Well 10017_TEM_F05
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence