Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T36290
Clone ID E36290
Template ID T36290
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Dnahc5
Gene description dynein, axonemal, heavy chain 5
Gene Aliases AU022615, Dnah5, KIAA1603, Mdnah5, mKIAA1603
MGI ID MGI:107718
Entrez Gene ID 110082
Ref Seq Accession NM_133365
Chromosome Location 15
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 092384_F_cDNA_Dnahc5
Forward Primer Sequences CTTCCTGGATGAGCTAATGGAC
Reverse Primer 092384_N_SP6_cDNA_Dnahc5
Reverse Primer Sequences GCGATTTAGGTGACACTATAGCTTCTGGAAGCTTCTCTAGCATA
Template Plate 10021_TEM
Template Well 10021_TEM_H05
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence